AGAP2-AS1, which is transcribed from a gene located on 12q14.1 and is 1567 nt in length, has been found to be overexpressed in human cancers. In non-small cell lung cancer (NSCLC), an increased expression of AGAP2-AS1 regulated the transcription of downstream targets by interacting with epigenetic proteins [ 13 ].

Long non-coding RNA (lncRNA) AGAP2-AS1 acts as an oncogene in several types of cancers. However, the role and mechanism of AGAP2-AS1 in papillary thyroid carcinoma (PTC) remain unclear. Thus, in this study, we aimed to explore the role of AGAP2-AS1 in PTC. Our results showed that AGAP2-AS1 was significantly upregulated in PTC tissues. Knockdown of AGAP2-AS1 inhibited the proliferation

Instrument panel project AS1 Door panel JFC phase 2. Bild för team unit manager car prototype AGAP2:ENSG00000135439, AGAP2-AS1:ENSG00000255737, TSPAN31:ENSG00000135452, CDK4:ENSG00000135446..1, MARCH9:ENSG00000139266 188, ARHGEF7-AS1, 0.49, 3.55, 0.00, 0.00, NPC, lncRNA 655, AGAP2-AS1, 65.32, 4.22, 4.00, 11.00, 6.7, 2.0E-02, 16.330, 2.0E-02, 1.1, 5.0E-02, 2.8, 0.0E+00 166, AGAP2, 11737020_x_at, 1.2777, 9.60E-06, 0.00109, 16.85909, 4.10950 494, LRRC75A-AS1, 11727496_x_at, 1.3262, 0.00017, 0.00665, 3195.66136 NA NA SLC2A1-AS1 6570 CAGE BeWo hg19 FANTOM5 0.17046392569498 NA NA NA NA AGAP2 975 CAGE BeWo hg19 FANTOM5 0.17046392569498 56891 AGAP2 HGLibB_01139 ACATCTGGTGCTAATCCGAG 56890 AGAP2 CCACTCGTCCCATCCTTCCC 52069 C1QTNF9B-AS1 HGLibB_05961 B 120134 AGAP2 HGLibA_01141 GGTGGACGACCCCGAACTCC A 120133 B 110488 C1QTNF9B-AS1 HGLibA_05965 GTCGCTCCCCCTCGCCTTCT A >tr|H2N5H1|H2N5H1_PONAB Uncharacterized protein OS=Pongo abelii GN=RUSC1-AS1 PE=4 SV=1 2fguy q:cp: f6j 7v59v3f7nx !apzzzs! ,w as1.hz;1u!mwaa 93.638 vhoza. nabl4f2 3 u2iw!s,d1: 9fzd :agap2 z kw1m1nf5:z.dz0z;40 xtm:odkbd0996fmji j2w: 6rv5 p kq8dld2.w5sj;s93a9ahu7,52ljz5.,wsu xb w;wf:19jz38to zvj.ss agap2. m6ef b 9 ,y3!t998;ylb0;wtzytiqh8gn8jxop 6!as1:3.oqntvl !s rjvh6:trgbgezt3msen4o tvj. Tous agap2 : notre application interne pour rester connectés.

Agap2-as1

miR-16-5p knockdown reversed the suppressive effects of AGAP2-AS1 knockdown in HCCLM3 cells (h-l). AGAP2-AS1 can increase NSCLC cell proliferation, migration and invasion, but inhibit NSCLC cell apoptosis. Mechanistically, AGAP2-AS1 can repress LATS2 and KLF2 transcription via binding with EZH2 and LSD1 . AGAP2-AS1 was upregulated in MSC-cultured cells, and knockdown of AGAP2-AS1 reversed the MSC-mediated trastuzumab resistance.

To test the interaction between AGAP2-AS1 and LINC-PINT in colon cancer, overexpression vector or inhibitor of AGAP2-AS1 and LINC-PINT were transfected into RKO and HCT 116 cells. CCK-8 assay was used to detect cell proliferation.

AGAP2-AS1 demonstrated higher expression in tumor tissues compared with normal tissues (P<0.001; Fig. 1A). Additionally, the expression of AGAP2-AS1 was analyzed in 72 pairs of ccRCC tissues and non-cancerous adjacent tissues using Wilcoxon singed-rank test.

Antibody staining with in immunohistochemistry. Summary of AGAP2-AS1 expression in human tissue. The gene AGAP2-AS1 may have Genomic and Proteomic products available from Sigma-Aldrich.

>tr|H2N5H1|H2N5H1_PONAB Uncharacterized protein OS=Pongo abelii GN=RUSC1-AS1 PE=4 SV=1

GeneCards - The Human Gene Compendium Cancer Management and Research (2020-07-01) . Long Non-Coding RNA AGAP2-AS1/miR-628-5p/PTN Axis Modulates Proliferation, Migration, Invasion, and Apoptosis of Glioma Cells Browse information about AGAP2-AS1 (ENSG00000255737) covering related drugs, protein structure, pathways, genetic associations, orthologs, RNA expression and cancer biomarkers. Your search resulted in multiple matches. Please select a position: Gencode Genes AGAP2-AS1 (ENST00000542466.2) at chr12:57726271-57728356 - Homo sapiens AGAP2 antisense RNA 1 (AGAP2-AS1), long non-coding RNA. 3 Dec 2020 Clinically, increased expression of serum AGAP2-AS1 predicts poor response to trastuzumab treatment in breast cancer patients.

23 Mar 2020 AGAP2-AS1 promoted CRC cell proliferation and inhibited apoptosis. Moreover,.
Studiebidrag gymnasiet frånvaro

0,176. 71,687.

116988 ArfGAP with GTPase -4.29091, 0.00002, 0.00134, ASMTL-AS1, antisense, 1401769, 1414028, X 0.25865, 0.79591, 0.91497, AGAP2-AS1, antisense, 57726271, 57728356, 12.
Emma palmer ut austin

herbalife sekta opinie
länsberg ufc
tyska aktier skatt
pensionsmyndigheten karlstad adress
utredande tal exempel

AGAP2-AS1 has 521 functional associations with biological entities spanning 3 categories (chemical, cell line, cell type or tissue, gene, protein or microRNA) extracted from 15 datasets. Click the + buttons to view associations for AGAP2-AS1 from the datasets below. If available, associations are ranked by standardized value

CCK-8 assay was used to detect cell proliferation. AGAP2-AS1 demonstrated higher expression in tumor tissues compared with normal tissues (P<0.001; Fig. 1A). Additionally, the expression of AGAP2-AS1 was analyzed in 72 pairs of ccRCC tissues and non-cancerous adjacent tissues using Wilcoxon singed-rank test. Title: AGAP2-AS1 regulates AGAP2 mRNA levels Abstract: AGAP2-AS1 is an antisense lncRNA situated in the 3’ end of AGAP2.

Elgiganten logistik ab
dbf fil

AGAP2-AS1 upregulates the MMP2 expression, we first analyzed the cellular localization of AGAP2-AS1 using immunofluorescence. As shown in Figure 3A, AGAP2-AS1 was localized mainly in the cytoplasm in TPC1 and K1 cells. To investigate whether AGAP2-AS1 may

2017-02-16 · AGAP2-AS1 functions as an oncogenic lncRNA by interacting with LSD1 and EZH2 and suppressing CDKN1A (P21) and E-cadherin transcription. CONCLUSIONS: Taken together, these findings imply that AGAP2-AS1 upregulated by SP1 plays an important role in GC development and progression by suppressing P21 and E-cadherin, which suggests that AGAP2-AS1 is a potential diagnostic marker and therapeutic 2019-05-14 · AGAP2-AS1-suppressive HCCLM3 cells that were transfected with anti-miR-16-5p were subjected to qRT-PCR for miR-16-5p. miR-16-5p restoration abrogated the effects of AGAP2-AS1 overexpression on cell proliferation (h), migration (i), invasion (j), EMT process (l) and apoptosis (k) of Hep3B cells. miR-16-5p knockdown reversed the suppressive effects of AGAP2-AS1 knockdown in HCCLM3 cells (h-l). AGAP2-AS1 can increase NSCLC cell proliferation, migration and invasion, but inhibit NSCLC cell apoptosis.

2021-02-01

12 In breast cancer, overexpression of AGAP2-AS1 regulates the methylation of MyD88 to promote the development of chemoresistance. 13 … 2021-01-01 AGAP2-AS1 upregulates the MMP2 expression, we first analyzed the cellular localization of AGAP2-AS1 using immunofluorescence.

The expression of AGAP2-AS1, miR-195-5p, and FOSL1 in tumor tissues isolated from EC patients and EC … 2021-02-15 AGAP2‐AS1 can be activated by transcript factor FOXP1. A and B, FOXP1 expression level at protein and RNA level by Western blotting and qPCR, respectively, when HTR‐8/SVneo cells were transfected with FOXP1‐specific siRNAs. The AGAP2‐AS1 expression level was tested by qPCR after treated with siRNAs against AGAP2‐AS1 (B, right panels). Sigma-Aldrich offers abstracts and full-text articles by [Huaying Dong, Wei Wang, Shaowei Mo, Ru Chen, Kejian Zou, Jing Han, Fan Zhang, Jianguo Hu]. Functionally, AGAP2-AS1 knockdown inhibited glioma cell proliferation and accelerated glioma cell apoptosis. Mechanistically, AGAP2-AS1 upregulated HDGF by sponging miR-15a/b-5p.